You are being redirected to the external resource authority website. If you haven't been redirected in 10 seconds, please click http://www.wormbase.org/db/get?name=WBStrain00033388.

For additional information about this resource, such as mentions, alerts, rating and validation information, please view our Resource Report (shown below).

View Resource Report


Organism Name
RM2005
RRID:WB-STRAIN:WBStrain00033388 RRID Copied  
PDF Report How to cite 
RRID:WB-STRAIN:WBStrain00033388
Copy Citation Copied
Organism Information

URL: http://www.wormbase.org/db/get?name=WBStrain00033388

Proper Citation: RRID:WB-STRAIN:WBStrain00033388

Description: Caenorhabditis elegans with name unc-75(md1344) I. from WB.

Species: Caenorhabditis elegans

Synonyms: unc-75(md1344) I.

Notes: Small, coily Unc; aldicarb resistant. 780-bp deletion: TTCGGTTCGTGTTTTTTATTGATATTTTTT /-----/ACAACATCCATTCGTCACAAGCTGCTATCA. Reference: Loria PM, et al., Curr Biol. 2003 Aug 5;13(15):1317-23.|"Supplementary_genotype unc-75 (md1344) I"

Affected Gene: WBGene00006807(unc-75)

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts
Report Information

No rating or validation information has been found for RM2005.

No alerts have been found for RM2005.

Data and Source Information

Source: Integrated Animals

Source Database: WormBase (WB)