Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/104188
Proper Citation: RRID:Addgene_104188
Insert Name: Zfp521 promoter - 1 Kb
Organism: Mus musculus
Bacterial Resistance: Ampicillin
Defining Citation: PMID:27506447
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Comments: pGL3 backbone is a promoterless vector used for measuring the activity of inserted promoter sequences with a luciferase assay. Primers used to clone 1Kb Zfp521 promoter: Forward: cgtttaaaaactattttcttatccaga Reverse: aatggaaaatccaagcaagg
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for 1kb Zfp521 promoter reporter.
No alerts have been found for 1kb Zfp521 promoter reporter.
Source: Addgene
