Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/117518
Proper Citation: RRID:Addgene_117518
Insert Name: BpiI:ACTA:pU6-26:sgRNA-EF:t192bp:TTAC:BpiI
Organism: Synthetic
Bacterial Resistance: Ampicillin
Defining Citation: PMID:30625150
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pICH47751; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: Cloned by Laurence Tomlinson. Primers to amplify a sgRNA: Fw: ga GGTCTCa ATTG [x] GTTTAAGAGCTATGCTGGAA, where [x] is the 20nt spacer/target sequence (NOT including the PAM). Rv: tgtggtctcaAGCGAAAAAAAGCACCGACTC (for polyT terminator) tgtggtctcaAGCGACCCCAGAAATTGAAC (for 67 bp U6-26 terminator, recommanded) tgtggtctcaAGCGTATTGGTTTATCTCATCG (for 192 bp U6-26 terminator). The PCR amplicon is ready to clone in a Golden Gate fashion with U6-26 promoter (pICSL90002) and any Golden Gate compatible acceptor vector Level 1, using BsaI. Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for LBJJ382.
No alerts have been found for LBJJ382.
Source: Addgene
