Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/118840
Proper Citation: RRID:Addgene_118840
Bacterial Resistance: Ampicillin
Defining Citation: PMID:30385465
Vector Backbone Description: Vector Backbone:MiniCoopR; Vector Types:CRISPR, Tol2; Bacterial Resistance:Ampicillin
Comments: Use the BseRI enzyme to clone gRNA of interest in the U6:gRNA cassette. Use primer: CCATACCACATTTGTAGAGGT to sequence insert
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for MiniCoopR U6:gRNA, mitfa:Cas9.
No alerts have been found for MiniCoopR U6:gRNA, mitfa:Cas9.
Source: Addgene
