Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/15379
Proper Citation: RRID:Addgene_15379
Insert Name: short hairpin RNA against mouse Mi-2 beta
Organism: Mus musculus
Bacterial Resistance: Ampicillin
Defining Citation: PMID:16452502
Vector Backbone Description: Backbone Marker:Smale Lab; Backbone Size:8290; Vector Backbone:pQsupR; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
Comments: Target sequence: GACTACGACCTGTTCAAGCAG
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pQsupR-Mi2b.
No alerts have been found for pQsupR-Mi2b.
Source: Addgene
