Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/15682
Proper Citation: RRID:Addgene_15682
Insert Name: YAP
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:16894141
Vector Backbone Description: Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: The human YAP ORF was cloned into the pBABEpuro vector as an EcoRI–BamHI fragment. A single FLAG tag was added to the N terminus during PCR with the following primers: Hs.YAP.F, CCGGGATCCACCATGGATTACAAGGATGACGACGATAAGATGGACCCCGGGCAGCAGCCCGCCGC; and Hs.YAP.R, CCGGAATTCCTATAACCATGTAAGAAAGCTTTC.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pBABE YAP1.
No alerts have been found for pBABE YAP1.
Source: Addgene
