Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/160138
Proper Citation: RRID:Addgene_160138
Insert Name: AsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
Organism: Synthetic
Bacterial Resistance: Kanamycin
Defining Citation: PMID:33547443
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pT7-AsCas12a_crRNA-site3 (RTW549).
No alerts have been found for pT7-AsCas12a_crRNA-site3 (RTW549).
Source: Addgene