Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/162042
Proper Citation: RRID:Addgene_162042
Insert Name: natR412 guide
Organism: Synthetic
Bacterial Resistance: Ampicillin
Defining Citation: PMID:34042294
Vector Backbone Description: Backbone Size:11240; Vector Backbone:pML104; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: This plasmid is derived from Addgene plasmid #67638 pML104 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites. Guide sequence: GTACCGCACCAGTGTCCCGG
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pML104-natR412.
No alerts have been found for pML104-natR412.
Source: Addgene
