Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/17681
Proper Citation: RRID:Addgene_17681
Insert Name: c-src S17A
Organism: Gallus gallus
Bacterial Resistance: Ampicillin
Defining Citation: PMID:2474754
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pEVX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: pcAlal7 was constructed by inserting the synthetic double-stranded DNA oligomer GATCCCAGCCAGCGCCGGCGGGCCCGGTCGGTCGCGGCCGCCCGGGA between the BamHI (codon 10) and BstNI (codon 18) sites of pcAlal2.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pcAla17.
No alerts have been found for pcAla17.
Source: Addgene
