Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/195857
Proper Citation: RRID:Addgene_195857
Insert Name: Amber Chromogenic Protein on pRCPam plasmid
Organism: Acropora millepora
Bacterial Resistance: Chloramphenicol
Defining Citation: PMID:38107993
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCPam; Bacterial Resistance:Chloramphenicol
Comments: Primer sequences for confirmation of suppressor mutation: Sense PCR primer (5'-->3') - TTGAGGTAATGCTTGAGATGG Antisense PCR primer (5'-->3') - TCCTGCCAGCGTTTATTG Sequencing primer (5'-->3') - CACAGCGCGTCTTTGTTTAC
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for XA103+pRCPam.
No alerts have been found for XA103+pRCPam.
Source: Addgene
