Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Plasmid Name
XA106+pRCPam
RRID:Addgene_195858 RRID Copied  
PDF Report How to cite
RRID:Addgene_195858
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/195858

Proper Citation: RRID:Addgene_195858

Insert Name: Amber Chromogenic Protein on pRCPam plasmid

Organism: Acropora millepora

Bacterial Resistance: Chloramphenicol

Defining Citation: PMID:38107993

Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCPam; Bacterial Resistance:Chloramphenicol

Comments: Primer sequences for confirmation of suppressor mutation: Sense PCR primer (5'-->3') - TCCTTCTCTGGTGTTGTTTG Antisense PCR primer (5'-->3') - TTGGCTGCTCTGACTTTG Sequencing primer (5'-->3') - CGGTTGACCTTGAGAGAGTTAAT

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for XA106+pRCPam.

No alerts have been found for XA106+pRCPam.

Data and Source Information

Source: Addgene