Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/196902
Proper Citation: RRID:Addgene_196902
Insert Name: 8xHis-tag is attached to the N-terminus of rnhA (RNase HI) Kanamycin resistant gene is inserted upstream of rnhA
Organism: Other
Bacterial Resistance: Kanamycin
Defining Citation: PMID:37159417
Vector Backbone Description: Vector Backbone:this is a strain; Vector Types:; Bacterial Resistance:Kanamycin
Comments: Primers: (1)CACCAATCTCAATGATCTTGTGG, (2)CAGTCATAGCCGAATAGCCT, (3)CGGTGCCCTGAATGAACTGC, (4)GCGTCCGCGATAGCGTAAA. Expected product size: 666 bp with primer (1) and (2), 1042 bp with primer (3) and (4). Guzit is a RNase HI(rnhA) His-tagged E. coli strain made for a cell-free expression system. His-tagged RNase HI expressed from the rnhA gene can be removed using Ni-NTA resin upon the preparation of cell-free extract. A kanamycin resistant gene was inserted upstream of rnhA using the λ-Red recombination system. Precuorsor strain is Rosseta 2. Please visit https://www.biorxiv.org/content/10.1101/2022.07.28.501919v1 for bioRxiv preprint.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for Guzit.
No alerts have been found for Guzit.
Source: Addgene
