Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/198849
Proper Citation: RRID:Addgene_198849
Insert Name: CYTB-W77-R14 TALEN
Organism: Rattus norvegicus
Bacterial Resistance: Ampicillin
Defining Citation: PMID:37058569
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pGL3-MTS-CYTB-W77-R14-G1333N-UGI-Puro.
No alerts have been found for pGL3-MTS-CYTB-W77-R14-G1333N-UGI-Puro.
Source: Addgene