Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/20976
Proper Citation: RRID:Addgene_20976
Insert Name: HOXA9
Organism: Mus musculus
Bacterial Resistance: Ampicillin
Defining Citation: PMID:18474618
Vector Backbone Description: Backbone Size:6500; Vector Backbone:MSCV-PGK-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: Mutant seq for all 3 miRNa sites is 5'- ctggagttagagaaggagtttctgtttaacatgtatttaacacgggaccgcagatatgag The nucleotide sequence should not change the aa sequence. Has ribosomal recognition site (ACC) in front of the ATG protein coding start site.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for HOXA9-micro-MSCV.
No alerts have been found for HOXA9-micro-MSCV.
Source: Addgene
