Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/26117
Proper Citation: RRID:Addgene_26117
Bacterial Resistance: Kanamycin
Vector Backbone Description: Backbone Marker:SGC Oxford; Backbone Size:7218; Vector Backbone:pNIC-CH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: pET expression vector with C-terminal His6 tag. Includes sites for LIC cloning, and a “stuffer” fragment that includes the SacB gene, allowing negative selection on 5% sucrose. GenBank accession number: EF199843 Primers for LIC cloning: Add the following 5’ extensions to the PCR primers: Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon) Downstream: AATGGTGGTGATGATGGTGCGC The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector. See supplemental document for more information.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pNIC-CH.
No alerts have been found for pNIC-CH.
Source: Addgene
