Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/27385
Proper Citation: RRID:Addgene_27385
Insert Name: post- ligation product of ligase ribozyme
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:19965478
Vector Backbone Description: Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: pH307HP is used to transcribe RNA representing the post- ligation product of the ribozyme. To ensure a homogenous 5´ terminus with the 5´- hydroxyl resembling that of the synthetic substrate, the transcript began with a hammerhead (HH) self-cleaving ribozyme, which excises itself from the ribozyme. The relevant sequence of the insert is GCGTAATACGACTCACTATAGGGAGATTCCTACTGGACTGATGAGTCCGTGAGGACGAA ACGGTACCCGGTACCGTCTCCAGTAGGAACACTATACTACTGGATAATCAAAGACAAAT CTGCCCGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCT CCGGTGGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCC TCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGG GACCCAC See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was digested with EarI nuclease.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pH307HP.
No alerts have been found for pH307HP.
Source: Addgene
