Resource Summary Report  New Search

URL: http://www.addgene.org/30121

Proper Citation: RRID:Addgene_30121

Bacterial Resistance: Ampicillin

Vector Backbone Description: Backbone Size:5279; Vector Backbone:pFastBac Dual; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin

Comments: This plasmid is a LIC-adapted pFastBac Dual vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector is a dual expression vector, and your 2 genes can be inserted in any order (check your gene for internal restriction sites, as this may dictate cloning order). LIC site v1: Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize vector with SspI and gel purify. T4-treat vector with dGTP. For the PCR product, T4-treat with dCTP. LIC site v2 LicV2 Forward Tag TTTAAGAAGGAGATATAGATC(ATG) LicV2 Reverse Tag TTATGGAGTTGGGATCTTATTA Linearize vector with EcoRV and gel purify. T4-treat vector with dCTP. For the PCR product, T4-treat with dGTP. To sequence LIC site v1, use the following primers: LicBac dual V1 F cctataactattccggattattcataccgtc LicBac dual V1 R caggttcagggggaggtgtg To sequence LIC site v2, use the following primers: LicBac dual V2 F gtcatagcgcgggttccttcc LicBac dual V2 R ggagtatacggacctttaattcaaccc For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Expand All Collapse