Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/31981
Proper Citation: RRID:Addgene_31981
Insert Name: LOVS1K
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:21802009
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pTriEx 3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Cloning primers: 5' end: CATGCCATGGGGACTAGTTTGGCTACTACACTTGAACGTATTGA 3' end: CTAGCTAGCCAGTGAGTGGATGCCAGGGTTG LOVS1K should be co-expressed with Orai1, such as Orai1 CFP (http://www.addgene.org/19757) or Orai1 YFP (http://www.addgene.org/19756/) deposited by Anjana Rao.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for LOVS1K.
No alerts have been found for LOVS1K.
Source: Addgene
