Resource Summary Report  New Search

URL: http://www.addgene.org/40325

Proper Citation: RRID:Addgene_40325

Insert Name: MCP-1 promoter (mutated)

Organism: Mus musculus

Bacterial Resistance: Ampicillin

Defining Citation: PMID:10973278

Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin

Comments: Note: Addgene NGS results identified an extra ~500 bp region upstream of the expected promoter, which contains a CMV enhancer feature. It is unknown what impact the region may have on plasmid function, but the extra sequence appears to have been present in the original sample received by Addgene. A plasmid containing the mouse MCP-1 promoter driving luciferase (pMCP-Luc) was constructed from pGL3-basic (Promega, Madison, WI) and a PCR-generated MCP-1 promoter fragment. A proofreading competent Taq reagent (AccuTaq, Sigma) was used to ensure high fidelity PCR. 1.2 kb of the MCP-1 promoter (GenBank Accession no. U12470) was obtained by PCR of C57BL/6 mouse DNA with the following primers: 5′–TCATGTATATGGCTTTCCAGGTCT–3′ (sense strand, distal to transcription start) 5′–TGCACTTCTGGCTGCTCTGAG GCA–3′ (antisense strand, proximal to transcription start) The PCR product terminates 28-bp downstream of the MCP-1 TATA site. XmaI and XhoI sites were added to the MCP-1 promoter by a second round of PCR with the primers: 5′–ATATCACCCGGGTCATGTATATGGCTTTCCAGGTCT–3′ 5′–TAGATTCTCGAGTGCACTTCTGGCTGCTCTGAGGCA–3′ and XmaI and XhoI were used to clone the MCP-1 promoter fragment into pGL3-basic. For the construction of the MCP-1 mutant promoter, the BCL-6 site was mutated by a two step PCR–based strategy using the above flanking primers and the following complementary primers to mutate the BCL-6 site: 5′–TCTCTCTTCCACTTCCT[TT]AAACA–3′ 5′–TGTTT[AA]AGGAAGTGGAAGAGAGA–3′ (mutated bases are in brackets) The mutant promoter was cloned into pGL3 via XhoI and XmaI. The wild-type and mutant MCP-1 promoter sequences were verified by sequencing.

Expand All Collapse