Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/45633
Proper Citation: RRID:Addgene_45633
Insert Name: Nectin-3 in situ probe
Organism: Mus musculus
Bacterial Resistance: Ampicillin
Defining Citation: PMID:19793993
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Comments: The Nectin-3 fragment was amplified by RT-PCR using the following primer pair: AAACAACCTGATCCGCAAAG CAGTGAAAACTGTAAAGCAGCTC For in vitro transcription, use the BamHI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1626-2039 of NM_021495, not bp# 1624-2036 as indicated on plasmid map. The plasmid functions as described in the associated publication.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pCRII-Topo Nectin-3 in situ probe.
No alerts have been found for pCRII-Topo Nectin-3 in situ probe.
Source: Addgene
