Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Plasmid Name
pIhh-5A9-LUC
RRID:Addgene_46318 RRID Copied  
PDF Report How to cite
RRID:Addgene_46318
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/46318

Proper Citation: RRID:Addgene_46318

Insert Name: 5 copies of A9 sequence from Ihh promoter

Bacterial Resistance: Ampicillin

Defining Citation: PMID:19906842

Vector Backbone Description: Backbone Marker:Yang lab; Vector Backbone:Luc reporter vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Comments: Five copies of the WT A9 (GATCCAAAGGGAATGTTGCC) were inserted upstream of the TATA box (a 16 bp sequence) from the mouse osteocalcin gene 2 promoter (OG2-TATA box), which is followed by the Luc gene.

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pIhh-5A9-LUC.

No alerts have been found for pIhh-5A9-LUC.

Data and Source Information

Source: Addgene