Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/46318
Proper Citation: RRID:Addgene_46318
Insert Name: 5 copies of A9 sequence from Ihh promoter
Bacterial Resistance: Ampicillin
Defining Citation: PMID:19906842
Vector Backbone Description: Backbone Marker:Yang lab; Vector Backbone:Luc reporter vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Five copies of the WT A9 (GATCCAAAGGGAATGTTGCC) were inserted upstream of the TATA box (a 16 bp sequence) from the mouse osteocalcin gene 2 promoter (OG2-TATA box), which is followed by the Luc gene.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pIhh-5A9-LUC.
No alerts have been found for pIhh-5A9-LUC.
Source: Addgene
