Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/46893
Proper Citation: RRID:Addgene_46893
Insert Name: SH3BP4 W92A
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:22575674
Vector Backbone Description: Backbone Marker:clonetch; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Mutagenesis was performed using a site-directed mutagenesis kit (Stratagene) and the following primer: cacatctggcggtgaggcgtggtacgcacacaac
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pRK5-HA-SH3BP4 W92A.
No alerts have been found for pRK5-HA-SH3BP4 W92A.
Source: Addgene