Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/46966
Proper Citation: RRID:Addgene_46966
Insert Name: AtU6p::sgRNA_PDS
Organism: Synthetic
Bacterial Resistance: Kanamycin
Defining Citation: PMID:23929340
Vector Backbone Description: Backbone Size:6340; Vector Backbone:pICH86966; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin
Comments: gRNA target sequence GCCGTTAATTTGAGAGTCCA
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pICH86966::AtU6p::sgRNA_PDS.
No alerts have been found for pICH86966::AtU6p::sgRNA_PDS.
Source: Addgene
