Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/48293
Proper Citation: RRID:Addgene_48293
Bacterial Resistance: Ampicillin
Vector Backbone Description: Backbone Size:4729; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a MYFQSNA fusion tag on the N-terminus To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify.When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ Note: The plasmid as it is provided enocdes "MYFQSNI". However, the vector is supposed to be cut with SspI (AATATT), which is a blunt cutter that cuts between the N and the "I" (this ends up not being transcribed, however). Then, provided you use the LIC tags on your PCR primers that we've suggested, the forward primer will introduce an A residue immediately downstream of the N. The final tag, therefore, is MYFQSNA.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pET MYFQSNA tagged cloning vector with BioBrick polycistronic restriction sites (9U).
No alerts have been found for pET MYFQSNA tagged cloning vector with BioBrick polycistronic restriction sites (9U).
Source: Addgene
