Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Plasmid Name
FN 108
RRID:Addgene_50495 RRID Copied  
PDF Report How to cite
RRID:Addgene_50495
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/50495

Proper Citation: RRID:Addgene_50495

Insert Name: fibronectin

Organism: Homo sapiens

Bacterial Resistance: Ampicillin

Defining Citation: PMID:7929152

Vector Backbone Description: Vector Backbone:pVC70108; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Comments: Primers used for amplification of insert: primer A (CCATATGGGTCGACCCAACTGG), which contains an NdeI site, methionine start codon, and 5' end of the 9th type III repeat sequence, and primer B (ATGAATTCTACATCTGGGATGGTTTGTCAA), which contains an EcoRI site, a stop codon, and the 3' end of the 37-kDa fibronectin fragment.

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for FN 108.

No alerts have been found for FN 108.

Data and Source Information

Source: Addgene