Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/55168
Proper Citation: RRID:Addgene_55168
Bacterial Resistance: Ampicillin
Defining Citation: PMID:24295448
Vector Backbone Description: Backbone Marker:Guerout-Fleury, et al. 1996; Vector Backbone:pDG1662; Vector Types:Synthetic Biology, Bacillus BioBrick Box; Bacterial Resistance:Ampicillin
Comments: This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli. For sequencing of inserts, use the following primers: fwd: AAAGGTCATTGTTGACGCGG rev: GAGCGTAGCGAAAAATCC
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pBS1C.
No alerts have been found for pBS1C.
Source: Addgene
