Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/61263
Proper Citation: RRID:Addgene_61263
Bacterial Resistance: Kanamycin
Defining Citation: PMID:25548049
Vector Backbone Description: Backbone Size:4979; Vector Backbone:pCM66; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: In order to use plasmid pAWP78, inserts should be added by Gibson Cloning. Primers to amplify the backbone have been annotated on the depositor's plasmid map. The sequences are (5' to 3'): AP259_pAWP78_fwd1 - TTGTCGGGAAGATGCGTGAT AP254_pAWP78_rev1 - CAGCTCACTCAAAGGCGGTA
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pAWP78.
No alerts have been found for pAWP78.
Source: Addgene
