Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Plasmid Name
pU6_(GLuc)_INT[GFPApt]
RRID:Addgene_68428 RRID Copied  
PDF Report How to cite
RRID:Addgene_68428
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/68428

Proper Citation: RRID:Addgene_68428

Insert Name: INT construct_bearing the GFP aptamer

Organism: Synthetic

Bacterial Resistance: Ampicillin

Defining Citation: PMID:26030444

Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin

Comments: sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a GFP aptamer.

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pU6_(GLuc)_INT[GFPApt].

No alerts have been found for pU6_(GLuc)_INT[GFPApt].

Data and Source Information

Source: Addgene