Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/73715
Proper Citation: RRID:Addgene_73715
Insert Name: pU6::sgRNA
Organism: Other
Bacterial Resistance: Ampicillin
Defining Citation: PMID:26837755
Vector Backbone Description: Backbone Marker:Agilent Technologies; Vector Backbone:pBluescript II; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: 2nd Insert: SapI repair template insertion site; sgRNA insert can be sequenced with oMLS471: 5' - TCCAAGAACTCGTACAAAAATGCTC
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pMLS256.
No alerts have been found for pMLS256.
Source: Addgene