Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/11663
Proper Citation: RRID:Addgene_11663
Insert Name: FF3
Organism: Firefly
Bacterial Resistance: Chloramphenicol and Ampicillin
Defining Citation: PMID:16141338
Vector Backbone Description: Backbone Size:8509; Vector Backbone:pPRIME-CMV-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: CMV promoter transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site. Please note: plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGCTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC). Addgene sequence shows that there is a single nucleotide deletion in the targeting sequence(AGCTCCCG-X-TGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC). According to the depositing lab, hairpin function is not disrupted.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pPRIME-CMV-GFP-FF3.
No alerts have been found for pPRIME-CMV-GFP-FF3.
Source: Addgene
