Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/132549
Proper Citation: RRID:Addgene_132549
Insert Name: human miR-302 cluster: MIR302B, MIR302C, MIR302A, MIR302D, MIR367
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:31673026
Vector Backbone Description: Backbone Marker:Broad Insitute; Backbone Size:8405; Vector Backbone:pCW57-GFP-2A-MCS; Vector Types:Mammalian Expression, Lentiviral, Doxycycline inducible, microRNA expression; Bacterial Resistance:Ampicillin
Comments: MIR302 cluster was PCR-amplified from genomic DNA using the following primers: Fwd - ACACCGGTGAAGTTGTATGTTGGGTGGGCT; Rev - CGTGTACACGTTATTTAACAATCCATCACCATTGCTAAAGT and cloned into pJET. pJET was digested using AgeI/BsrGI and inserted into AgeI/BsrGI digested pCW57-GFP-MCS vector (Addgene #71783).
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pCW57-GFP-miR-302cluster.
No alerts have been found for pCW57-GFP-miR-302cluster.
Source: Addgene
