Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/160381
Proper Citation: RRID:Addgene_160381
Insert Name: Ago- Dcr
Organism: Saccharomyces cerevisiae
Bacterial Resistance: Ampicillin
Vector Backbone Description: Backbone Size:7959; Vector Backbone:pESC; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: AGO1 and DCR1 genes were amplified from S. castellii gDNA using primersatac gcggccgc aacgatgtcatccaattcgg+ and atac gcggccgc agcacataaactctttgttc, respectively. Plasmid pESC-LEU was converted to leu2::NAT derivative via short-homology in vivo replacement using PCR product generated using primers AAGCAAGGATTTTCTTAACTTCTTCGGCGACAGCATCACCGACTTCGGTGc agc tga agc ttc gta cgc+tttttccaataggtggttagcaatcgtcttactttctaacttttcttacct agg cca cta gtg gat ctg and pAG25 template. AGO1 was cloned into NotI site of pESC-NAT to yield pESC-NAT-AGO1 plasmid. DCR1 was cloned into ApaI/XhoI site of pESC-NAT-AGO1 to yield pESC-NAT-AGO1-DCR1 plasmid.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pESC-NAT-Ago-Dcr.
No alerts have been found for pESC-NAT-Ago-Dcr.
Source: Addgene
