Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/160390
Proper Citation: RRID:Addgene_160390
Insert Name: L-A Gag-Pol
Organism: Saccharomyces cerevisiae
Bacterial Resistance: Ampicillin
Vector Backbone Description: Backbone Marker:J Virol . 1993 May;67(5):2764-71. doi: 10.1128/JVI.67.5.2764-2771.1993.; Backbone Size:9854; Vector Backbone:PJD1223; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: pJD1223-NAT was constructed by short-homology in vivo replacement of TRP1 on pJD1223 (J Virol . 1993 May;67(5):2764-71) with NAT PCR product generated using primers TATTGAGCACGTGAGTATACGTGATTAAGCACACAAAGGCAGCTTGGAGTcagctgaagcttcgtacgc and caagtgcacaaacaatacttaaataaatactactcagtaataacctattttaggccactagtggatctg from pAG25.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for PJD1223.
No alerts have been found for PJD1223.
Source: Addgene
