Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/163574
Proper Citation: RRID:Addgene_163574
Insert Name: Dcp2
Organism: Saccharomyces cerevisiae
Bacterial Resistance: Ampicillin
Defining Citation: PMID:32553117
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for Dcp2 FL.
No alerts have been found for Dcp2 FL.
Source: Addgene