Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/165480
Proper Citation: RRID:Addgene_165480
Bacterial Resistance: Ampicillin
Defining Citation: PMID:24510647
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pTriEx-1.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Primers for LIC cloning: Upstream: add TTAAGAAGGAGATATACT to the 5' end of gene of interest. Downstream: add GATTGGAAGTAGAGGTTCTCTGC to the 3' end of GOI. For vector: digest with BfuAI (BspMI) before LIC-treatment. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pRB30.
No alerts have been found for pRB30.
Source: Addgene