Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/175275
Proper Citation: RRID:Addgene_175275
Insert Name: EGFP-Synaptobrevin-2; tdTomato
Organism: Other
Bacterial Resistance: Ampicillin
Defining Citation: PMID:34824475
Vector Backbone Description: Backbone Size:4561; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: Sequencing may be difficult due to secondary structure/dimerization. The following primers have been used in the Xu lab: 5': actcagcgctgcctcagtc (upstream of tdTomato) 3': ggccatgttgttgtcctcggaggaggcggtgc (in tdTomato) 5': gggcatggcaccggcagcaccggcagcggcagc (in tdTomato) 3': gctgaacttgtggccgtttacgtcg (in EGFP) 3': cagggtcagcttgccgtaggtggcatcg (in EGFP)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pAAV-SynaptoTAG2.
No alerts have been found for pAAV-SynaptoTAG2.
Source: Addgene
