Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/215000
Proper Citation: RRID:Addgene_215000
Insert Name: msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template
Organism: Mus musculus
Bacterial Resistance: Ampicillin
Vector Backbone Description: Vector Backbone:pTwist-Amp; Vector Types:HDR template; Bacterial Resistance:Ampicillin
Comments: Use the following genomic target sequence: GGGACGGTCACCTTCCCTGGGGG ( final "GGG" is the PAM site) . Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pTwist Amp msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template.
No alerts have been found for pTwist Amp msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template.
Source: Addgene
