Resource Summary Report  New Search

URL: http://www.addgene.org/27386

Proper Citation: RRID:Addgene_27386

Insert Name: unligated form of ligase ribozyme

Organism: Homo sapiens

Bacterial Resistance: Ampicillin

Defining Citation: PMID:19965478

Vector Backbone Description: Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Comments: Improved class I ligase modified at the end of P5 with four additional base pairs terminating in the U1A- binding loop. DNA representing the unligated form of this ribozyme was subcloned into pUC19 under a T7 transcription promoter, followed by a genomic hepatitis delta virus (HDV) self-cleaving ribozyme and an EarI restriction site, yielding the plasmid p307HU. The HDV sequence cleaves itself from the ribozyme 3´ terminus, thereby producing a homogenous ribozyme 3´ end. The relevant sequence of the insert was GCGTAATACGACTCACTATAGGAACACTATACTACTGGATAATCAAAGACAAATCTGCC CGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCTCCGGT GGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCCTCGCT GGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGGGACCC AC See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was digested with EarI nuclease.

Expand All Collapse