Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/31305
Proper Citation: RRID:Addgene_31305
Insert Name: Mesothelin
Organism: Homo sapiens
Bacterial Resistance: Kanamycin
Defining Citation: PMID:21505261
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Adenoviral; Bacterial Resistance:Kanamycin
Comments: Msln Promoter sequence provided by author (see above link) Please note that Addgene was unable to sequence verify this plasmid. The depositing laboratory PCR amplified two regions of this plasmid using the following primer pairs and sequenced the resulting PCR products to confirm the plasmid. Msln-1F: TCATTTGTTCCCTTTGACGGC Msln-1R: CTCTCCCCAGCATCCACATTC Expect 987 nt product Msln-2F: TTGCCTACAACACCCTGCTGCG Msln-2R: GCTCACAATGCTTCCATCAAACG Expect 792 nt product
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pAdEasy-Msln-iCre-HA-Flag.
No alerts have been found for pAdEasy-Msln-iCre-HA-Flag.
Source: Addgene
