Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/31613
Proper Citation: RRID:Addgene_31613
Insert Name: PICK1 (shRNA insensitive) +shRNA towards PICK1
Organism: Rattus norvegicus
Bacterial Resistance: Ampicillin
Defining Citation: PMID:21147983
Vector Backbone Description: Backbone Marker:David Baltimore (Caltech); Backbone Size:9941; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: This is the replacement construct which expresses an shRNA to knockdown the endogenous protein and a recombinant GFP-tagged, shRNA-resistant protein, to replace the endogenous PICK1. shRNA sequence: CTATGAGTACCGCCTTATCCT
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for GFP-PICK.
No alerts have been found for GFP-PICK.
Source: Addgene
