Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/32586
Proper Citation: RRID:Addgene_32586
Insert Name: Intronic HCN1miRNA and EGFP
Bacterial Resistance: Kanamycin
Defining Citation: PMID:21772812
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P4r-P3r; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: HCN1miRNA TAAAGACGACAGTAGGTATCAG Du, G., Yonekubo, J., Zeng, Y., Osisami, M., and Frohman, M. A. (2006). Design of expression vectors for RNA interference based on miRNAs and RNA splicing. FEBS J. 273, 5421–5427.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pENTR-R4r-HCN1miR-EGFP-R3r.
No alerts have been found for pENTR-R4r-HCN1miR-EGFP-R3r.
Source: Addgene
