Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Plasmid Name
pCRII-Topo Tmtc4
RRID:Addgene_45869 RRID Copied  
PDF Report How to cite
RRID:Addgene_45869
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/45869

Proper Citation: RRID:Addgene_45869

Insert Name: TMTC4 in situ probe

Organism: Mus musculus

Bacterial Resistance: Ampicillin

Defining Citation: PMID:19793993

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin

Comments: The Tmtc4 fragment was amplified by RT-PCR using the following primer pair: GAAGCAGAGCAGAGCTACCG TCTGAACAGAGGCTTCATGC For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pCRII-Topo Tmtc4.

No alerts have been found for pCRII-Topo Tmtc4.

Data and Source Information

Source: Addgene