Resource Summary Report  New Search Previous Search Results

URL: http://www.addgene.org/55186

Proper Citation: RRID:Addgene_55186

Bacterial Resistance: Kanamycin

Defining Citation: PMID:23410102

Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7266; Vector Backbone:pET, pCoofy3; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Comments: C-terminal tags are separated by a stop codon. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' CBP - SLIC Primer 5`ATGAAGCGGCGGTGGAAGAAAAAC 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Expand All Collapse