Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/71486
Proper Citation: RRID:Addgene_71486
Insert Name: loxP-hyg-loxP cassette
Organism: Synthetic
Bacterial Resistance: Ampicillin
Defining Citation: PMID:25779316
Vector Backbone Description: Backbone Marker:Kenan Murphy; Backbone Size:2741; Vector Backbone:pKM328; Vector Types:Bacterial Expression, Source of loxP-hyg-loxP for PCR amplification.; Bacterial Resistance:Ampicillin
Comments: The floxed hyg cassette is flanked by AscI sites, which can be recovered by restriction digestion for use in the construction of recombineering substrates, or amplified by PCR using the following targeting sequences: CGCTCTAGAACTAGTGGATCC ATGCCTGCAGGTCGACTC
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pKM342.
No alerts have been found for pKM342.
Source: Addgene
