Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Plasmid Name
PMXS-NDI1
RRID:Addgene_72876 RRID Copied  
PDF Report How to cite
RRID:Addgene_72876
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/72876

Proper Citation: RRID:Addgene_72876

Insert Name: NDI1

Organism: Saccharomyces cerevisiae

Bacterial Resistance: Ampicillin

Defining Citation: PMID:24670634

Vector Backbone Description: Backbone Size:5639; Vector Backbone:pMXs-IRES-blasticidin; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin

Comments: The retroviral NDI1 vector was generated by cloning into the EcoRI and XhoI sites of the pMXS-ires-blast vector a cDNA insert generated by PCR using the primers below, followed by standard cloning techniques. Ndi1 EcoRI F: ATGAATTCCATCACATCATCGAATTAC Ndi1 XhoI R: ATCTCGAGAAAAGGGCATGTTAATTTCATCTATAAT It is a retroviral plasmid so it may be recommended to be propagated at 30oc but author typically grows it at 37oC.

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for PMXS-NDI1.

No alerts have been found for PMXS-NDI1.

Data and Source Information

Source: Addgene