Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/83446
Proper Citation: RRID:Addgene_83446
Insert Name: SOD1
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:29128334
Vector Backbone Description: Backbone Marker:David Root; Backbone Size:10065; Vector Backbone:pLEX_307 (plasmid #41392); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: PCR cloning (F: TAAGCAGCTAGCAGCTCAGATCTCGAGCTCAAGC, R: TAAGCAACTAGTTCATTGGGCGATCCCAATTACACC) followed by cleanup, NheI/SpeI restriction digestion of PCR product and destination vector, gel purification and ligation.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pLEX_307-SOD1E133insTT.
No alerts have been found for pLEX_307-SOD1E133insTT.
Source: Addgene