Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/83479
Proper Citation: RRID:Addgene_83479
Insert Name: DLD
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:29128334
Vector Backbone Description: Backbone Marker:PMID: 26186194; Backbone Size:10056; Vector Backbone:pPHAGE C-TAP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: Mutation (first described in PMID: 17404228) was created using the method described in PMID: 17446874. Two outer (F: CTCTTGGTTTGCATTGGCCG, IRES_R: CCTCACATTGCCAAAAGACG) and two mutation-site primers were used. The mutated PCR product and the backbone vector were digested using EcoRI, gel purified and ligated. Note that the mutation is numbered in accordance with the original publication (PMID: 17404228), which lacked the mitochondrial targeting signal (residues 1-35). In this full-length protein, it is found at position 491.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pPHAGE_DLD-S456A-C-TAP.
No alerts have been found for pPHAGE_DLD-S456A-C-TAP.
Source: Addgene
