Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/86613
Proper Citation: RRID:Addgene_86613
Insert Name: ATP1A1 G3 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
Organism: S. pyogenes
Bacterial Resistance: Ampicillin
Defining Citation: PMID:28417998
Vector Backbone Description: Vector Backbone:pX330-U6-Chimeric_BB-CBh-hSpCas9; Vector Types:Mammalian Expression, CRISPR, Co-selection via HDR using ouabain; Bacterial Resistance:Ampicillin
Comments: ATP1A1 G3 gRNA target sequence is GAGTTCTGTAATTCAGCATA
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA.
No alerts have been found for eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA.
Source: Addgene