Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Organism Name
SD-Leprem4Lizh
RRID:RGD_21079475 RRID Copied  
PDF Report How to cite
RRID:RGD_21079475
Copy Citation Copied
Organism Information

URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=21079475

Proper Citation: RRID:RGD_21079475

Description: Rattus norvegicus with name SD-Leprem4Lizh from RGD.

Species: Rattus norvegicus

Notes: The Lepr knockout rats were generated by CRISPR/Cas9. Two pairs of synthesized oligonucleotides for gRNA targeting on the exon 4 of Lepr, TAGGCAAATCATCTATAACTTC and AAACGAAGTTATAGATGATTTG; TAGGCTGAAAGCTGTCTTTCAG and AAACCTGAAAGACAGCTTTCAG were microinjected into Sprague Dawley (originally from Charles River) zygotes. The rat was genotyped by PCR with the primers, 5-prime-CTTGTGTCCAGAGCCTTCCTATAAC and 5-prime-ATTCCCCATGTTGTCTAGTAGTGATC. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. Founder 2 was chosen to establish a colony (designated as Lepr-/-), which carried a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA, deleting 997 amino acid of LEPR. Western blot analysis of total protein from liver tissue of the Lepr-/- rats confirmed the absence of LEPR.

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for SD-Leprem4Lizh.

No alerts have been found for SD-Leprem4Lizh.

Data and Source Information

Source: Rat Genome Database (RGD) (RRID:SCR_006444)
Description: Database for genetic, genomic, phenotype, and disease data generated from rat research. Centralized database that collects, manages, and distributes data generated from rat genetic and genomic research and makes these data available to scientific community. Curation of mapped positions for quantitative trait loci, known mutations and other phenotypic data is provided. Facilitates investigators research efforts by providing tools to search, mine, and analyze this data. Strain reports include description of strain origin, disease, phenotype, genetics, immunology, behavior with links to related genes, QTLs, sub-strains, and strain sources.
URL: http://rgd.mcw.edu

Source Database: Rat Genome Database (RGD)