Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=401938653
Proper Citation: RRID:RGD_401938653
Description: Rattus norvegicus with name SD-Ctnsem1Odev from RGD.
Species: Rattus norvegicus
Notes: The Ctns gen was deleted by oocyte injection of the CRISPER/Cas9 system (PolyGene AG, Zurich,Switzer-land). Two single guideRNAs(sgRNAs) targeting exon3 of Ctns were selected :CRISPR1a: ACCAACGTCAGCATTAC-CCT(TGG), CRISPR1b: CCATTTACCAGCTTCACAGT(GGG). This Ctns rat line harboring a deletion of 12bp and insertion of 8bp resultingin a premature stop codon in the exon3 of Ctns. Contact Olivier Devuyst at Email: [email protected], National BioResource Project for the Rat in Japan
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SD-Ctnsem1Odev.
No alerts have been found for SD-Ctnsem1Odev.
Source: Rat Genome Database (RGD) (RRID:SCR_006444)
Description: Database for genetic, genomic, phenotype, and disease data generated from rat research. Centralized database that collects, manages, and distributes data generated from rat genetic and genomic research and makes these data available to scientific community. Curation of mapped positions for quantitative trait loci, known mutations and other phenotypic data is provided. Facilitates investigators research efforts by providing tools to search, mine, and analyze this data. Strain reports include description of strain origin, disease, phenotype, genetics, immunology, behavior with links to related genes, QTLs, sub-strains, and strain sources.
URL: http://rgd.mcw.edu
Source Database: Rat Genome Database (RGD)
